By what method do the gases oxygen and carbon dioxide pass into or out of the bloodstream?

Which of the following is not a defining characteristic of plants?

Step 1 review the imaginary strand of dna below. note the complementary base pairs. a g c a a t c c g t c t t g g t c g t t a g g c a g a a c c step 2 to begin replicating this strand of dna, draw the two sides of the strand separating. step 3 now, draw the free-floating bases linking up with the separate sides. remember to follow the rules of complementary base pairing. step 4 draw the two resulting dna strands.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?