Biology, 07.01.2021 22:40, lorilhuff8197

Select all the correct answers. This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein-coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

Select all the correct answers.

This sequence encodes for a particular protein that helps bacteri

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 03:40, ES123

Imagine you are introducing the lac operan and the trp operon to students who have never learned about it before. complete the table to compare the similarities and differences between the two operons

Answers: 3

continue

Biology, 22.06.2019 04:10, zairaefh3200

Select the correct answer. tay-sachs disease is caused by a mutation in the hexa gene located on chromosome 15. tay-sachs follows an autosomal recessive pattern of inheritance. with the of the diagram, identify which of the offspring will be an unaffected carrier. a diagram showing the genes of parents who are carriers of tay-sachs disease a. a, b, and c b. b and c c. a and d d. a e. d

Answers: 3

continue

Biology, 22.06.2019 12:50, cindy14772

The many stone tools, fragmentary animal bones, and teeth found at gran dolina, spain, indicate that hominids there? a. processed and consumed animals and other hominids. b. did not differ appreciably from earlier asian homo erectus. c. were similar to later homo sapiens. d. none of the above

Answers: 1

continue

Biology, 22.06.2019 15:00, afrimart1

When fossil fuels are burned, carbon dioxide is released. how does this gas impact the environment?

Answers: 1

continue

Do you know the correct answer?

Select all the correct answers. This sequence encodes for a particular protein that helps bacteria...