Biology, 22.12.2020 21:20, payshencec21
Sickle cell anemia is a genetic condition that occurs because of a single base mutation in the DNA gene for hemoglobin. How is this mutation expressed in humans?
The protein coded by the DNA has a different amino acid sequence
The hormones in the blood are changed by increased differences in genes
The chromosome carrying this gene changes shape during cell reproduction
The carbohydrate coded by the DNA has a different structure
Answers: 2
Biology, 22.06.2019 09:50, heids17043
The frequency of alleles in a population that is in hardy weinberg equilibrium? a . changes in each successive generation b. is less important than the frequency genotypes c. shows evidence of the process of natural selection d. remains the same over several generations
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:30, ilovevegene
How do disease caused by bacteria and disease caused by viruses react to antibiotics?
Answers: 2
Sickle cell anemia is a genetic condition that occurs because of a single base mutation in the DNA g...
Mathematics, 11.10.2021 14:00
Computers and Technology, 11.10.2021 14:00
Health, 11.10.2021 14:00
Advanced Placement (AP), 11.10.2021 14:00
Mathematics, 11.10.2021 14:00
Business, 11.10.2021 14:00