Biology, 21.12.2020 16:40, only1kariyah

14. Fill in the cluster diagram with terms from the word bank. extinction genetic drift
mutation natural selection speciation
Evolution
Mechanisms
(migration
rapid environmental
change occurs
EXTENSION Add to the cluster diagram to show the conditions of natural selection.

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 08:00, yasmincastor

Why did mendel use pea plants in his experiments? a. they have no alleles. b. they are haploid organisms. c. they reproduce quickly. d. they are all male.

Answers: 1

continue

Biology, 22.06.2019 09:30, alananicoleee

2. does the given statement describe a step in the transformation of the graph off(x) = x2 that would result in the graph of g(x) = -5x + 2)? a. the parent function is reflected across the x-axis. o yes nob. the parent function is stretched by a factor of 5. yes noonc. the parent function is translated 2 units up. o yes

Answers: 2

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Biology, 22.06.2019 13:30, brony2199

What is the correct order of cell division? include what happens in each phase

Answers: 2

continue

Do you know the correct answer?

14. Fill in the cluster diagram with terms from the word bank. extinction genetic drift
mutat...