Biology
Biology, 18.12.2020 17:00, tashatyron24pejls0

A woman discovers that her family has a history of a rare, X-linked genetic disorder that causes symptoms late in life. Her mother and father didn't have the disease, but all three of her brothers do. What is the probability that the woman will have the disease as well? 100%
75%
50%
25%
0%

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 08:00, ramseynikki87
How water is moving through the ecosystem ?
Answers: 2
image
Biology, 22.06.2019 10:20, opreston
Crossing over is a method of (blank)?
Answers: 1
image
Biology, 22.06.2019 11:30, itssergioa
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
A woman discovers that her family has a history of a rare, X-linked genetic disorder that causes sym...

Questions in other subjects:

Konu
Mathematics, 21.09.2020 02:01