Biology
Biology, 09.12.2020 21:00, 182075

Which statement is true? A. Most rocks are composed of a single mineral.
B. Most rocks are made up of a mixture of minerals.
C. Rocks do not contain any mineral matter.

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 05:30, breezy974
What is a sex-linked genetic disorder that disrupts the blood's ability to clot? a. achondroplasia b. huntington's disease c. hemophilia d. albinism
Answers: 2
image
Biology, 22.06.2019 10:30, ryliepeloquinf
Which prefix mean under less or below
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 14:20, Aliyah2020
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
Do you know the correct answer?
Which statement is true? A. Most rocks are composed of a single mineral.
B. Most rocks are ma...

Questions in other subjects:

Konu
Mathematics, 13.04.2020 23:37
Konu
Mathematics, 13.04.2020 23:37