Biology, 01.12.2020 14:00, annieeeeer

:(( I need more help! ASAP please Which specialized structure do nocturnal primates use to see better at night?
a tapetum lucidum
a grooming claw
a fused jaw
a tooth comb

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 14:40, blackx18

What kind of action is a cause of air pollution

Answers: 1

continue

Biology, 21.06.2019 18:40, 8343244

List two new traits (structural or behavioral) that each new species of rat might demonstrate as it adapts to the conditions on two of the four islands. choose only two islands that are described in the lesson. record the island latter and the major habitat feature of the island. then list two new traits each rat subspecies might demonstrate in order to survive the habitat on that island. note: new traits should be unique to that island and be in response to that island’s habitat feature. i cannot remember islands that were names in the lesson so only answer if you have done the lesson (5.13 life science 7b) choose 2 of the islands and describe a structural and a behavioral trait for a rat on each island so 4 total answers, 2 different structurals and 2 different behaviorals, one for each rat for each island

Answers: 3

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Biology, 22.06.2019 14:50, dondre54

Read this summary of a scientific theory: "cells are the most basic structural and functional units of life. all living organisms are made up of one or more cells. all cells that are alive in the world today came from pre-existing cells." which of the following would require this theory to be modified? -a.) a survey finds that a majority of people believe viruses carry out the basic processes of life. -b.) a prominent scientist says she feels strongly that one day the theory will be challenged by life on other planets. -c.) the dna of unicellular and multi-cellular organisms is shown to have many fundamental similarities. -d.) scientific observations show that microscopic organisms living in the deep ocean are not made up of cells.

Answers: 1

continue

Do you know the correct answer?

:(( I need more help! ASAP please Which specialized structure do nocturnal primates use to see bett...