Biology
Biology, 29.11.2020 23:10, Zgt

Definition: All the individuals of a species that live together in one place at the same time Example: this of humans in the United States in 2005 is around 275,000,000

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 10:00, vadrian4056
Nephrons, the functional unit of kidneys, are responsible for formation of urine. the sentences describe situations that are the result of problems in the urine formation process. for the nephron shown below, match each situation to the step in the urine formation process where the problem lies.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 17:00, marioruiz7944
Which of the following do all living things have in common
Answers: 2
image
Biology, 22.06.2019 19:30, korban23
Which of the following statements is true regarding a basic amino acid? a.) the hydrophilic r group of a basic amino acid will be located on the interior of a protein b.) the positively charged r group of a basic amino acid could bind dna c.) the r group of a basic amino acid would only be able to form covalent bonds with other molecules d.) a basic amino acid would be considered both polar and hydrophobic e.) all of the above
Answers: 1
Do you know the correct answer?
Definition: All the individuals of a species that live together in one place at the same time Examp...

Questions in other subjects:

Konu
Physics, 24.08.2020 17:01
Konu
Mathematics, 24.08.2020 17:01
Konu
Mathematics, 24.08.2020 17:01