Answers: 1
Biology, 22.06.2019 10:00, vadrian4056
Nephrons, the functional unit of kidneys, are responsible for formation of urine. the sentences describe situations that are the result of problems in the urine formation process. for the nephron shown below, match each situation to the step in the urine formation process where the problem lies.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:00, marioruiz7944
Which of the following do all living things have in common
Answers: 2
Biology, 22.06.2019 19:30, korban23
Which of the following statements is true regarding a basic amino acid? a.) the hydrophilic r group of a basic amino acid will be located on the interior of a protein b.) the positively charged r group of a basic amino acid could bind dna c.) the r group of a basic amino acid would only be able to form covalent bonds with other molecules d.) a basic amino acid would be considered both polar and hydrophobic e.) all of the above
Answers: 1
Definition: All the individuals of a species that live together in one place at the same time
Examp...
Physics, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01
Chemistry, 24.08.2020 17:01
Social Studies, 24.08.2020 17:01
Mathematics, 24.08.2020 17:01