Biology
Biology, 29.11.2020 08:50, hooplikenari

An RNA sequence includes 15 codong, How many amino acids does this sequence encode

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 07:30, hcameron65
In which layer do organisms on earth love?
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:30, MikeCrotch19251
Are the layers of rock above and below the coal older or younger?
Answers: 1
image
Biology, 22.06.2019 15:00, NeverEndingCycle
The scales shown in the introduction measure mass, or the amount of matter in a particular object. the scientific law of conservation of mass states that matter cannot be created or destroyed during a chemical reaction, but it can change from one form to another. did the simulation support this scientific law? explain why or why not.
Answers: 1
Do you know the correct answer?
An RNA sequence includes 15 codong, How many amino acids does this sequence encode...

Questions in other subjects:

Konu
Mathematics, 02.05.2021 05:00