![Biology](/tpl/images/cats/biologiya.png)
Biology, 25.11.2020 07:40, Jaressayf4466
A team of students must design a hand warmer for a project. The hand warmer must reach and maintain a temperature of 35 °C. They
decide on a design process.
What steps are missing from the process? Move words and phrases to the blanks to complete the steps of the process.
Requirement
Positive
result
Problem
Create a
hand
warmer
Decide mixture
of chemicals
and fabrics.
Develop a
prototype.
Negative
result
Design new
prototype.
Test.
Retest.
Must reach
and maintain
35 °C
Conduct
background
research.
Decide on
new fabric
or chemicals.
![answer](/tpl/images/cats/otvet.png)
Answers: 3
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00, scadengo123
In addition to seeds, which of the following characteristics are unique to the seed-producing plants? a) sporopollenin b) lignin present in cell walls c) pollen d) use of air currents as a dispersal agent e) megaphylls
Answers: 1
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:00, mariana5493
What will happen if two of the base pairs of the stand of the dna are switched
Answers: 1
Do you know the correct answer?
A team of students must design a hand warmer for a project. The hand warmer must reach and maintain...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.01.2021 17:20
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.01.2021 17:20
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 24.01.2021 17:30
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.01.2021 17:30
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 24.01.2021 17:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.01.2021 17:30
![Konu](/tpl/images/cats/ekonomika.png)
Business, 24.01.2021 17:30
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.01.2021 17:30