A species was added into a particular ecosystem to control the population of a prey species. This method of introducing a new species is called

Which entry is in the wrong position in the table?

Select the correct answer. which mutation is harmful to the organism? a. a mutation allowing moths to camouflage better on blackened tree bark b. a mutation making staphylococcus aureus resistant to the antibiotic methicillin c. a mutation inhibiting human immunodeficiency virus from attaching to and entering the cell d. a mutation causing uncontrolled cell division e. a mutation giving plant leaves a bitter taste to discourage herbivores from eating them

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?