Biology
Biology, 22.11.2020 01:00, rose782751

Use the following experiment to answer questions #16-#20. The materials needed are an ice cube tray, water, a clear jar or glass, and food coloring (darker food colorings are better). 16) Mix the water and food coloring and pour it into the ice cube tray. Put the ice cube tray in the freezer till frozen. Once frozen, fill the clear glass with warm water. Add one colored ice cube to the glass. Observe what happens. What starts to happen?

17) Does the colored water sink or float?

18) Why does the colored water behave in this manner?

19) How does this experiment show heat transfer?

20) What is this process called?

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 16:30, poniatowski23
Plz plz plz quick! 49 points for whoever which of the following statements about greenhouse effect is true? *life on earth is suffering because of greenhouse effect *the greenhouse effect is caused by human activity *all greenhouse gases are harmful *life on earth would not exist without the greenhouse effect
Answers: 2
image
Biology, 22.06.2019 03:30, pineapplefun
The human genome project is devoted to mapping the general dna sequence of our species. this could lead to the development of new medicines, as well as the possibility of using gene therapy to treat certain diseases. however, there are some ethical issues surrounding the mapping of individual genomes. one concern is a) that your genes may change over time, making the project useless. b) that insurance companies could discriminate based on genetic make-up. c) that since this has never been done before, we should probably not do it now. d) that sequencing our individual genomes is so expensive, it is a counter-productive strategy.
Answers: 1
image
Biology, 22.06.2019 11:00, DuckieTime
If a grape were placed in a hypertonic solution what would happen and why?
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Use the following experiment to answer questions #16-#20. The materials needed are an ice cube tray,...

Questions in other subjects:

Konu
Advanced Placement (AP), 12.09.2021 01:50
Konu
Mathematics, 12.09.2021 01:50
Konu
Chemistry, 12.09.2021 01:50
Konu
Mathematics, 12.09.2021 01:50
Konu
Mathematics, 12.09.2021 01:50