![Biology](/tpl/images/cats/biologiya.png)
Biology, 12.11.2020 06:00, Bladedrose2351
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTA GAAG How many proteins were
![answer](/tpl/images/cats/otvet.png)
Answers: 2
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:40, edith47
Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to canadian breeding grounds in the spring. as global temperatures have increased due to climate change, spring has started arriving in the warbler's breeding grounds earlier in the year, before the warblers return. warblers now arrive at their breeding grounds too late to select ideal nesting sites and to feed on important early-spring food sources how are populations of blue-winged warblers most likely to be affected by the earlier arrival of spring? o a. populations will go extinct since the warblers will stop migrating to breeding grounds. b. populations will be unaffected since most species can quickly adapt to effects of climate change. c. populations will increase since warmer temperatures are generally beneficial to survival, d. populations will decline since individuals will be less likely to successfully reproduce, reset next
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:30, ariellewallenst4348
If the rna molecule in a human has the nucleotide sequence of guu, this would the amino acid valine would be needed to make the protein. how would this cha process was occurring in a mushroom?
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, xmanavongrove55
Chloroplasts and bacteria are in size. a. similar b. at different ends of the size range c. exactly the same d. none of these
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:00, tuetheturtle
The double bond between a carbon atom and two oxygen atoms (a molecule of carbon dioxide) has two characteristics. what are they? a. an ionic bond is formed between the oxygen and carbon atoms. b. four valence electrons are shared. c. two valence electrons are shared. d. valence electrons are shared between oxygen atoms.
Answers: 1
Do you know the correct answer?
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the enti...
Questions in other subjects:
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.03.2021 18:20
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/health.png)
Health, 24.03.2021 18:20
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 24.03.2021 18:20
![Konu](/tpl/images/cats/en.png)