Biology, 06.11.2020 21:10, 2000samantha

The size of an object affects its density.

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 01:10, nakeytrag

Osmosis is often viewed incorrectly as a process driven directly by differences in solute concentration across a selectively permeable membrane. what really drives osmosis? view available hint(s)osmosis is often viewed incorrectly as a process driven directly by differences in solute concentration across a selectively permeable membrane. what really drives osmosis? the first law of thermodynamicsthe difference in the height of water columns on either side of a selectively permeable membranethe difference in water concentration across a selectively permeable membranethe difference in sugar or ion concentration across a selectively permeable membrane

Answers: 2

continue

Biology, 22.06.2019 03:30, pineapplefun

The human genome project is devoted to mapping the general dna sequence of our species. this could lead to the development of new medicines, as well as the possibility of using gene therapy to treat certain diseases. however, there are some ethical issues surrounding the mapping of individual genomes. one concern is a) that your genes may change over time, making the project useless. b) that insurance companies could discriminate based on genetic make-up. c) that since this has never been done before, we should probably not do it now. d) that sequencing our individual genomes is so expensive, it is a counter-productive strategy.

Answers: 1

continue

Biology, 22.06.2019 05:00, pr4ever

Ronald wants to see if a new shower cleaner works better in removing soap than his old cleaner. he uses the new cleaner on one half of the shower tiles and his old cleaner on the other half. identify the independent and dependent variables in this experiment. enter your answer in the space provided.

Answers: 3

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Do you know the correct answer?

The size of an object affects its density....