Working with the Vocabulary: In your own words, explain how a person may taste the bitterness of PTC by using the following vocabulary words in your explanation (choose any order): trait, gene, genotype, phenotype, and alleles. Underline each word as you use it in your explanation. In this explanation, you can treat PTC taste sensitivity as a single-gene trait. [As mentioned in the video, it may be more complex than a single-gene trait.]

How is the carbon cycle related to global warming ?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

24. how are vaccines used to keep people healthy?