Answers: 1
Biology, 21.06.2019 18:30, narutoxptheninja
The gene that causes sickle-cell disease is present in a higher percentage of residents of sub-saharan africa than among those of african descent living in the united states. even though this gene causes sickle-cell disease, it also provides some protection from malaria, a serious disease that is widespread in sub-saharan africa but absent in the united states. discuss an evolutionary process that could account for the different percentages of the sickle-cell gene among residents of the two regions.
Answers: 2
Biology, 22.06.2019 10:50, isabelgarcia188
The small molecule cyclic amp (camp) takes about 0.2 second to diffuse 10 Ξm, on average, in a cell. suppose that camp is produced near the plasma membrane on one end of the cell; how long will it take for this camp to diffuse through the cytosol and reach the opposite end of a very large cell, on average? assume that the cell is 200 Ξm in diameter.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Where are extrusive igneous rocks typically found?...
Biology, 21.11.2020 01:20
History, 21.11.2020 01:20
English, 21.11.2020 01:20
History, 21.11.2020 01:20
Advanced Placement (AP), 21.11.2020 01:20