Biology, 22.10.2020 21:01, mckennacwilliams

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 04:30, dbenjamintheflash5

What type of organism is a one-celled organism that functions as a single unit? a. bi-celled b. single-celled c. pre-celled d. multi-celled

Answers: 2

continue

Biology, 22.06.2019 05:00, SmartScholar4094

Idon’t know the answer and i’ve been stuck on it for a while now skskskskks

Answers: 1

continue

Biology, 22.06.2019 07:30, sawyerharper

Which locations on the map are low-pressure areas? a b c d e

Answers: 1

continue

Biology, 22.06.2019 08:00, ladypink94

Can create a hboth of these instruments can measure wind speed. doppler radar and psychrometer anemometer and hygrometer doppler radar and anemometer radiosonde and psychrometer

Answers: 3

continue

Do you know the correct answer?

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and...

Questions in other subjects:

Mathematics, 06.05.2020 03:35

At a pizza shop you can choose thick or thin crust , red or white sauce, and toppings of pepperoni, cheese or vegetarian. Create a tree diagram to display the sample space...

Mathematics, 06.05.2020 03:35

Jay route in equation to determine the sales tax on an item you want to by the equation was Y equals 0.098 squared Y represent the amount of sales tax in XYZ is the cost of the ite...

Law, 06.05.2020 03:35

The long battle for civil rights in America took place in many settings. Many civil rights gains were made in the courts especially. Please describe how the battle over civil right...

Mathematics, 06.05.2020 03:35

Which of these shows line of symmetry? Select the three correct answers....

Mathematics, 06.05.2020 03:35

Hi please solve this for me!...

English, 06.05.2020 03:35

Commonlit animals role in human disease which quote from the text best supports the answer in part a...

History, 06.05.2020 03:35

In a short paragraph, describe what was done to make the masses (common people) happy during the Empire. Describe how differently the wealthy people of the Roman Empire lived durin...

Mathematics, 06.05.2020 03:35

Help me answer this question...

Arts, 06.05.2020 03:35

Rembrandt was able to reveal the character of his portrait subjects by using: a. Chiaroscuro b. Bright, ornate clothing c. Revealing background landscapes ...

Biology, 06.05.2020 03:35

Half the distance between a wave's crest and trough . A. amplitude B. crest C. electromagnetic radiation D. frequency E. longitudinal waves F. sound waves G. surface waves H. trans...

Other tasks in the category: Biology More task

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG 1)none 2)one 3)not enough information 4)three 5)two.

Answers

Other questions on the subject: Biology

Questions in other subjects:

The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.