Biology
Biology, 20.10.2020 03:01, msjbryant33

What cellular process allows unicellular organisms to reproduce?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 03:00, elishaheart21
Which statement best describes the relationship between an allele and a gene? question 1 a. an allele is a variation of a gene that can be expressed as a phenotype. b. an allele is the part of a gene that attaches to messenger rna molecules. c. an allele is a segment of a dna molecule that controls replication of a gene.
Answers: 3
image
Biology, 22.06.2019 11:30, rleiphart1
Can someone pretty me with this ? it’s urgent. compare the three theories of emotion. here are the three theories of emotion. cannon-bard theory of emotion: the belief that both psychological arousal and emotional experience are produced stimultaneously ( at the same time) by the same nerve stimulus. james-lange theory of emotion: the belief that emotional experience is a reaction to bodily events occurring as a result of an external situation. ( “ i feel sad because i am crying.) schachter-singer theory of emotion: the belief that emotions are jointly determined by a nonspecific kind of psychological (bodily function) arousal and its interpretation, based on environmental ( natural surroundings) cues. which of these theories makes most sense to you? why. your response should be written using proper english spelling and grammar. and it needs to be 10 complete sentences.
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 14:00, stephycake9768
Organelles found in plant cells that function through photosynthesis to produce glucose from carbon dioxide and water are called — question 21 options: chloroplasts guard cells photosynthons
Answers: 1
Do you know the correct answer?
What cellular process allows unicellular organisms to reproduce?...

Questions in other subjects:

Konu
Mathematics, 07.11.2019 01:31