Biology, 19.10.2020 08:01, dflorez3064

MAY give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Highlighted letters are: ATACTACC

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 14:30, mmpinkortizov5n3y

When should a bar graph be used? a. when there is no independent variable. b. when the independent variable is continuous and does not show a relationship to the dependent variable. c. when the independent variable is continuous and shows a causal link to the dependent variable. d. when the independent variable is composed of categories and does not show a relationship.

Answers: 2

continue

Biology, 21.06.2019 23:00, kksavage36

Compare the depth of field when focusing with low power and high power. which power has the greater depth of field?

Answers: 1

continue

Biology, 22.06.2019 04:30, jaeybird9

Types of scientific inquiry that biologist engage in that cannot be completely controlled

Answers: 1

continue

Biology, 22.06.2019 13:00, ngj312

As molecules are formed from metabolism, entropy __ and the universe becomes less disordered. a. is decreased b. is increased c. moves closer to equilibrium d. is unchanged

Answers: 3

continue

Do you know the correct answer?

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a part...