This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

what is it ❓

Explanation:

please follow me

there’s no image attached but i can if you want: )

answer: angiosperms

dicots

angiosperms are highly evolved plants, they produce seeds which are enclosed within in a carple. these are the largest group of plants on earth. they include trees, shrubs, herbs and small flowering plants. angiosperms exhibit a flowering stage in their life cycle. the flower serves the function of reproduction and fruit formation in majority of angiosperms. dicot is the term used to describe flowering plants that have two seed leaves. dicots are plants which develop seeds which split into two parts called cotyledons. each cotyledon contains one embryo.

here, a small purple flower development indicates that the plant belongs to angiosperms and having two embryonic leaves indicates it belongs to dicots.