Two frog populations (same species) living in two neighboring lakes sing slightly different courtship songs. Increased irrigation makes the land between the two lakes wetter, allowing frogs to expand their ranges to the area between the lakes. Females in both populations prefer loud frogs to quieter frogs but do not distinguish between the two slightly different songs. Assuming that courtship song differences are due in part to genetic differences, predict what will likely happen to the songs of the two frog populations. a. The gene flow between hatchery-reared and wild populations is leading to a decline in fitness of wild populations.
b. The gene flow between hatchery-reared and wild populations is neither helping nor hindering the fitness of the wild population.
c. This data does not help us understand effects of gene flow on fitness. The gene flow between hatchery-reared and wild populations is increasing the fitness of the wild populations.
d. You cannot predict a change in the courtship songs at the two lakes.

The energy needs of a human population are not affected by

Indicate the coat color and the proportion of offspring with that color for each of the following crosses of rabbits. assume all are homozygous. albino x albino a) 1/4 chinchilla, 3/4, agouti b) 3/4 albino, 1/4 chinchilla c) all albino

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?