Biology
Biology, 23.12.2019 20:31, iBrain

What rule is used to join the free nucleotides to the exposed bases of the dna?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 10:00, Billyr9088
Cladistics is a way of classifying organisms by examining the characteristics of their ancestors and descendants and depicting the relationships in a cladogram. which of the following best describes a challenge in classifying organisms this way? a. there are millions of species on earth, and a cladogram is not a practical means for classifying all of them. b. it is impossible to tell which organisms are most closely related to each other using a cladogram. c. cladograms are detail-oriented and do not provide a useful understanding of evolutionary relationships. d. there is a limited number of ways to organize the information, so most cladograms end up looking very similar.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, davisnaziyahovz5sk
Which soil would most likely be found in the arctic? andisols gelisols histosols spodosols
Answers: 1
image
Biology, 22.06.2019 20:00, noeminm105
What two conditions must be present for osmosis to occur?
Answers: 1
Do you know the correct answer?
What rule is used to join the free nucleotides to the exposed bases of the dna?...

Questions in other subjects:

Konu
Mathematics, 26.04.2021 22:20
Konu
History, 26.04.2021 22:20