A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

During an investigation of an xss attack, the investigator comes across the term "[a-za-z0-9\%]+" in analyzed evidence details. what is the expression used for?

How many species of living things are alive on earth today? more than 1,000,000 none of these answers are correct 100-500 1,000 –500,000 o 500,000 -1,000,000

Asolution of an enzyme and a substrate was placed in a water bath and the temperature of the reaction was raised gradually. the graph shown was plotted at the end of the experiment. what can be concluded from the graph? a) temperature has no effect on the activity of the enzyme. b) the effect of temperature on the enzyme is unpredictable. c) the enzyme shows increased activity up to a certain temperature. d) the activity of the enzyme is inversely proportional to the temperature.