A. Over a period of 10 days, I asked the
teacher to keep the door open. I then
measured the temperature of the room and
body core temperature. I also recorded
whether I sweated or not. I then repeated
this procedure 10 days with the door open.
This is most closely associated with
which step in the scientific method?

How many chromosomes are in a gold fish?

Ayoung boy has been found and police are trying to locate his family they take a dna sample from him and begin collec dna samples from families who have missing children if police use dna samples only from the fathers, which type of dn technology can they use to identify the boy's parent? y-chromosome analysis omtdna (mitochondrial dna) analysis vntrs (variable tandem repeats) o pcr (polymerase chain reaction) analysis

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?