Help help help help
...
Answers: 3
Biology, 21.06.2019 14:30, ThePotato381
5) these are organisms where the genetic material is not bound by a nucleus. they are usually unicellular.
Answers: 1
Biology, 22.06.2019 03:00, ladnerhailey16
Lola needs to sign 6 invitations. using stopwatch that measures time to tenths of a second, it takes lola 5.3 seconds to sign her full name. going by the accuracy of the stopwatch, which is the most accurate determination for the number of minutes lola needs to sign all 96 invitations
Answers: 1
Biology, 22.06.2019 09:10, dmarte11092001
Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 31.03.2020 22:38
Social Studies, 31.03.2020 22:38
Mathematics, 31.03.2020 22:38
Mathematics, 31.03.2020 22:38
English, 31.03.2020 22:38
Mathematics, 31.03.2020 22:38
English, 31.03.2020 22:38