Biology
Biology, 20.09.2020 07:01, jmanrules200

I need help with my biology work please


I need help with my biology work please

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:30, ineedhelp2285
Deer cave cannot support photosynthesis is as not enough sunlight is present. in spite of this, it still has a complex food chain. what is the energy foundation of this food chain?
Answers: 1
image
Biology, 22.06.2019 09:10, kaciebrin211
Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.
Answers: 1
image
Biology, 22.06.2019 10:30, ccarwile01
Apopulation of rabbits live in a local forest. some had a mutation for a large body and long legs. the graph below shows the number of both the mutant and the normal rabbits over 5 generations. which of the following statements is true for this scenario? question 7 options: the rabbits with the mutation were more successful with restricted food than the normal rabbits. both sets of rabbits were equally successful with the restricted food source. i the normal rabbits were more successful with restricted food than the rabbits with the mutation. the graph does not let us know which rabbit was more successful.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
I need help with my biology work please
...

Questions in other subjects:

Konu
English, 01.10.2021 15:10
Konu
Mathematics, 01.10.2021 15:10
Konu
Mathematics, 01.10.2021 15:10