Biology, 03.09.2020 18:01, dolphin146
Thomson's contribution to the atomic theory was the
discovery that negatively-charged electrons were
embedded within a positively-charged "soup". Later
on Rutherford preformed the gold foil experiment
which altered Thomson's contribution. What were
the conclusions of Rutherford's Gold Foil
Experiment?
O The atom is made up of mostly empty space with a tiny,
dense, positively-charged nucleus.
O The atom is mostly empty space, with negative charge
concentrated at the center.
O The atom is mostly empty space, with positive charges
spread evenly across it.
O The atom is mostly empty space. No other conclusions
could be made.
Answers: 1
Biology, 22.06.2019 00:00, isaacb6291
How do diseases caused by bacteria and diseases caused by viruses react to antibiotics?
Answers: 1
Biology, 22.06.2019 03:00, mariaaalopezz
Discuss the functions of epithelial connective nerviud and muscular tissues
Answers: 3
Biology, 22.06.2019 10:30, lexiemornelas
During a fierce storm a large number of tall trees on an island are uprooted by the wind and die. most of the trees on the island are now short trees and produce seeds that grow into short trees. what concept is shown in this example? question 5 options: natural selection artificial selection genetic engineering gene splicing
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Thomson's contribution to the atomic theory was the
discovery that negatively-charged electrons wer...
Mathematics, 11.06.2020 01:57
English, 11.06.2020 01:57
Mathematics, 11.06.2020 01:57