Biology
Biology, 14.08.2020 23:01, thechocolatblanc

b) What are the bases of mRNA coded for by this section of DNA, after the mutation? Hint: In RNA, A pairs with U. HELP PL

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 16:00, emwemily
Where in the body can you find chemoreceptors? a. on the skin and ears, to detect pressure, touch, motion, and sound b. on the retina, to detect a single photon of light c. on the skin, to detect temperature or specific chemicals d. on the tongue and in the nose, to detect taste or odor
Answers: 2
image
Biology, 22.06.2019 09:00, s6054682
What substance is the most acidic. lemon juice. tomato juice. sodium hydroxide. water
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:10, ciara180
People with one sickle cell allele are not likely to get malaria. what is this an example of?
Answers: 1
Do you know the correct answer?
b) What are the bases of mRNA coded for by this section of DNA, after the mutation? Hint: In RNA, A...

Questions in other subjects:

Konu
Computers and Technology, 30.03.2021 16:00