Biology, 14.08.2020 23:01, thechocolatblanc
b) What are the bases of mRNA coded for by this section of DNA, after the mutation? Hint: In RNA, A pairs with U. HELP PL
Answers: 3
Biology, 21.06.2019 16:00, emwemily
Where in the body can you find chemoreceptors? a. on the skin and ears, to detect pressure, touch, motion, and sound b. on the retina, to detect a single photon of light c. on the skin, to detect temperature or specific chemicals d. on the tongue and in the nose, to detect taste or odor
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
b) What are the bases of mRNA coded for by this section of DNA, after the mutation? Hint: In RNA, A...
Social Studies, 30.03.2021 16:00
SAT, 30.03.2021 16:00
Mathematics, 30.03.2021 16:00
English, 30.03.2021 16:00
Computers and Technology, 30.03.2021 16:00
Mathematics, 30.03.2021 16:00