AUGGUUACCAUCGCUUAUAA TRANSLATE

One gene can influence trait(s). one trait can be determined by gene(s).

Cathy hypothesized that corn would not grow in mud. to test this hypothesis, she took corn kernels and placed 5 in mud, 3 in soil, and 2 in water. to her surprise, the kernels in the mud grew faster than the kernels in the soil. what error might have caused these unexpected results? a. wrong hypothesis b. not enough variables c. undefined control d. too many variables

In sheep, the allele for belly fur (a) is dominant to the allele for no belly fur (a). a mother with the genotype aa and a father with the genotype aa produce an offspring.