Biology, 06.10.2019 21:30, tae1731

What is the role of these bacteria in the nitrogen cycle?

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 16:00, prettygirllniyiaa

Which of the following examples can cause gene flow between populations? a. an increase in predators to a population of zebra b. a volcanic eruption that kills half of a population of mice c. bird droppings that contain seeds from a different location d. a person that sprays a toxin on a group of mosquitoes

Answers: 2

continue

Biology, 22.06.2019 06:20, noahdeem135

What is the importance of having the us forest service, the bureau of land management, the us fish and wildlife service, and the national park service? to manage land resources for conservation and the development of natural resources to manage land resources for conservation and the development of urban areas to preserve historical landmarks and manage the development of urban areas to preserve historical landmarks and manage the development of rural areas

Answers: 3

continue

Biology, 22.06.2019 10:00, austinmiller3030

Suppose you use three different scale to weigh a bag of organges. one scale says the nag weighs 2.1 lb, and third says it weighs 2.1 lb. the actual weight of the bag of organges is 2.153 lb. which of the following best decribes these results?

Answers: 3

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?