Biology
Biology, 05.08.2020 07:01, priceb17

In order for a pea plant to show a recessive trait, what alleles must be present? A. two dominant alleles

C. one dominant and one
recessive allele

B. two recessive alleles

D. none of the above

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:40, DragonLovely
Competition occurs between species when
Answers: 1
image
Biology, 22.06.2019 00:00, tylerchitwood211
The table below shows the number of foot bones in some horse fossils. horse fossil recordhorse fossil number of foot bonesp 19q 17r 24s 13ancient horses had more bones in their foot then present-day horses. the present-day horse has 11 foot bones. what is the correct order of evolution of the horse starting from the youngest fossil? a. q p r s b. s r p q c. s q p r d. r p q s
Answers: 3
image
Biology, 22.06.2019 10:30, ccarwile01
Apopulation of rabbits live in a local forest. some had a mutation for a large body and long legs. the graph below shows the number of both the mutant and the normal rabbits over 5 generations. which of the following statements is true for this scenario? question 7 options: the rabbits with the mutation were more successful with restricted food than the normal rabbits. both sets of rabbits were equally successful with the restricted food source. i the normal rabbits were more successful with restricted food than the rabbits with the mutation. the graph does not let us know which rabbit was more successful.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
In order for a pea plant to show a recessive trait, what alleles must be present? A. two dominant a...

Questions in other subjects:

Konu
Mathematics, 31.01.2022 14:00
Konu
Social Studies, 31.01.2022 14:00