Which is an advantage of producing genetically engineered crops that have pest-resistant genes? A) Bioaccumulation of pesticides B) Allows farmers to grow any crop they want C) Reduces the use of pesticides for certain insects D) Gene transfer to nontarget species
Answers: 2
Biology, 21.06.2019 20:00, zozo72
After reading the paragraph below, answer the questions that follow. researchers have created a robot that has a very thin leg that is moved by cardiac (heart) cells contracting in unison. the robot, made of a polymer similar to that used in making contact lenses, is bathed in heart cells with supporting cells, which then attach to the robot and provide movement as they contract. all of the cardiac cells working together can cause the robot leg to move in a way that individual cells could not. this is an example of a. emergent properties of cells. b. energy flow through an ecosystem. c. adaptation. d. internal environment regulation.
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 23.06.2019 00:30, majailaharris200
Paleontologists have found plant fossils deep within the layers of the north polar region. these leaf fossils have been labeled as to the rock layers they were found in, with the lower numbers being layers close to the earth's surface and higher numbers representing deeper layers. according to the numbers of these four leaf fossils, what might you infer?
Answers: 3
Which is an advantage of producing genetically engineered crops that have pest-resistant genes? A) B...
Health, 28.08.2019 21:00
Mathematics, 28.08.2019 21:00
Mathematics, 28.08.2019 21:00
Health, 28.08.2019 21:00
Mathematics, 28.08.2019 21:00
History, 28.08.2019 21:00