Answers: 1
Biology, 21.06.2019 18:00, gora2005
1. the passing of is the basis of heredity. 2. our encode the instructions that define our traits. 3. each of us has thousands of genes, which are made of and reside in our chromosomes. 4. in addition to our genes, the we live in also define our traits. 5. humans have two complete sets of chromosomes. 6. when parents conceive a child, each parent contributes set of chromosomes. 7. every child receives of its chromosomes from the mother and half from the father. 8. this transfer takes place at when the father’s sperm joins the mother’s egg. 9. while most cells in our bodies have two sets of chromosomes, or a total of egg and sperm each have chromosomes. 10. when egg and sperm unite they create a single cell called a 11. each parent contributes complete set of chromosomes to their child. 12. since the parents contribute the chromosomes to each new child, every child inherits a unique set of chromosomes. 13. as a result, every baby will have a combination of traits.
Answers: 1
Biology, 21.06.2019 23:10, gobbler80
Getting out of bed is the first goal i tackle each day. 2several small goals are achieved by me as the day progresses. 3when i am riding the bus home or walking the dog, i think about the bigger goals i have for my life. which statement correctly describes the verb tense, aspect, and voice in this paragraph? a. sentences 1 and 2 contain present progressive verbs. sentence 3 contains both present progressive and simple present verbs. sentence 2 uses passive voice. b. sentences 1 and 2 contain simple present verbs. sentence 3 contains present progressive verbs. all three sentences use active voice. c. sentences 1 and 2 contain present progressive verbs. sentence 3 contains simple present verbs. all three sentences use active voice. d. sentences 1 and 2 contain simple present verbs. sentence 3 contains both present progressive and simple present verbs. sentence 2 uses passive voice.
Answers: 3
Biology, 22.06.2019 03:30, Neko1kat
Recombinant dna (rdna) creates offspring which are genetically identical to the parent is the process of breeding only organisms with desirable traits involves the removal of the nucleus of a cell combines genes from organisms of different species in a lab
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
How does evolution lead to both biodiversity and commonalities among life?...
Mathematics, 19.11.2020 20:10
English, 19.11.2020 20:10