Biology
Biology, 27.06.2020 02:01, deeknuk

Read the excerpt from Immigrant Kids, by Russell Freedman. But the journey was not yet over. Before they could be admitted to the United States, immigrants had to pass through Ellis Island, which became the nation's chief immigrant processing center in 1892. There they would be questioned and examined. Those who could not pass all the exams would be detained; some would be sent back to Europe. And so their arrival in America was filled with great anxiety. Among the immigrants, Ellis Island was known as "Heartbreak Island." Which answer choice best paraphrases this excerpt? Ellis Island, the major processing center for immigrants in 1892, was called “Heartbreak Island” by the immigrants. If they failed to pass all the required examinations, they would be detained on the island, and perhaps even sent back to the country they came from. All in all, the process was frightening for an immigrant. Ellis Island was the main processing center for immigrants in 1892. There the immigrants were given exams and questioned by authorities. If they were not able to pass all the tests, they could be sent back to their homeland, or detained. Immigrants called Ellis Island “Heartbreak Island” for a reason. The United States government was unfair in the way it decided who could come into the country and who would be sent back to their native land. Instead of evaluating the immigrants so harshly, the officials should have been more welcoming. Before they could enter the United States, immigrants had to pass through Ellis Island, which was the country’s main processing center for immigrants in 1892. There they would be asked questions and tested. Those who could not pass all the tests would be kept on island; some would be sent back to their own country. Among the immigrants, Ellis Island was known as “Heartbreak Island.”

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 14:40, kahliey
Select all the correct answers. which statements fail to meet the requirements of a scientific claim? 1 even though evidence indicates that the solar system's planets follow elliptical paths, copernicus's model involving circular orbits is true. 2 the evidence supporting newton's laws of motion was accurate in newton's time, but the universe operates differently today. 3 flowers that reflect the most ultraviolet light are more likely to attract bees and other pollinators than flowers that reflect less ultraviolet light. 4 in the final 100 meters of a 10,000-meter race, an athlete's speed is more strongly related to anaerobic efficiency than to aerobic efficiency.
Answers: 2
image
Biology, 22.06.2019 04:00, AlysonDvz5464
Which of the following types of rock would most likely contain a fossil? slate granite lava rock limestone
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, shan8747
Anormal strand of dna is shown below, followed by the same strand of dna after mutations have occurred.
Answers: 3
Do you know the correct answer?
Read the excerpt from Immigrant Kids, by Russell Freedman. But the journey was not yet over. Before...

Questions in other subjects:

Konu
Mathematics, 20.09.2020 05:01
Konu
Biology, 20.09.2020 05:01
Konu
Mathematics, 20.09.2020 05:01