1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'
Given that the temperature required breaking, one bond in the molecule is 12°C. What is
the total temperature required to completely break the entire DNA molecule.
a 48°C
b. 57.6°C
C. 240°C
d. 480°C
e. 576°C

due to the fact that it skipped a generation we can tell it is definitely not a dominant trait, therefore it must be recessive. i think this is right let me know!

explanation:

"1. it should be, it has been for about 20 years, and it's really not much different in the end than breeding animals to have particular traits. there are always concerns about genetically engineered animals/plants affecting the environment in unexpected negative ways, but i can't think of an example where the fears didn't turn out to be baseless.  

first, as you point out, it would be a great advance in pharmacology, to be able to tailor drugs and their doses to me. the pros involve better medical treatment. the cons involve privacy issues like insurance companies denying coverage to people with genetic risk factors. looking at dna markers wouldn't affect the frequency of genetic diseases, but it would allow detection of them earlier. and ok, actually i suppose that if people used this information to avoid having children with genetic diseases, some might decrease in frequency."

organ system-an organ system is a group of organs that work together to perform one or more functions. each does a particular job in the body, and is made up of certain tissues.

true                                                                                                       true true true true true true