What happens if the buoyant force on an object is less than the weight of the object?
O A. The object floats on top of the liquid without being submerged.
B. The object floats in the liquid but is completely submerged.
O c. The object sinks to the bottom of the liquid.
O D. The object floats near the surface of the liquid and is only partially
submerged.

Anormal appearing couple is found to be heterozygous recessive for albinism both have the genotype aa the gene responsible for albinism is recessive to the normal pigment-producing gene what are the changes of their children being albino

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Astudent from one of the research labs is having trouble preparing a slide for examination and photographing. the bacterial slide that he has brought to you was prepared using a commercially purchased stain. he has asked for your in determining what he is doing wrong so that he can change the lab protocols and continue on with his project. after examining the slide under oil immersion, you determine that no bacteria are present even though the student is able to show you the culture he used to make that slide that has visible growth in the liquid medium. which of the following statements does not explain the fact that there are no bacteria present on the student’s slide? by not allowing a glass slide to completely air dry before heat fixation, the flame will cause the surrounding water to boil and this will damage the bacterial cell. overheating during the fixation step boiled the water within the bacterial cells and resulted in the cells bursting. insufficient heating of the slide did not drive out the thin layer of water and this resulted in minimal bonding between the bacteria and the glass slide. rinsing with alcohol during the washing step stripped the bacteria off the glass slide. rinsing with alcohol during the washing step stripped the bacteria off the glass slide.