Sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT

Awater molecule is polar because there is an uneven distribution of these between the oxygen and hydrogen atoms.

In a hypothetical breed of dogs, coat color is controlled by two genes. there are six different coat colors in this breed: black, brown, cream, gray, silver, and tan. consider the following crosses. cross 1: black females from a lineage of all black dogs are crossed with brown males from a lineage of all brown dogs. f1 males and females are all black. when f1 are intercrossed, f2 males and females are black or brown. cross 2: black females from a lineage of all black dogs are crossed with tan males from a lineage where all males are tan and all females are cream. f1 males are black, f1 females are gray. when f1 are intercrossed, f2 males and females are black, brown, gray, or tan. cross 3: silver females from a lineage where all females are silver and all males are gray are crossed with brown males from a lineage of all brown dogs. f1 males and females are all gray. when f1 are intercrossed, f2 males are black, brown, gray, or tan, f2 females are cream, gray, silver, or tan. select the correct statements regarding the mode of inheritance of the coat color genes. a) both genes are x-linked. b) both genes are autosomal. c) one of the genes modifies the expression of the other gene. d) each gene has an additive effect on the intensity of coat color. e) each gene independently specifies three colors. f) one of the genes is autosomal, and the other is x-linked.

Many animals cannot sweat to maintain a stable body temperature. what is one other way animals can cool down?