What are the forelimbs of a chimpanzee adapted for?what are they adapted for in humans

What evidence did mendel find that supported his law of independent assortment? a. dominant traits are expressed when there is a dominant allele. b. traits do not affect the inheritance of other traits. c. some traits have three or four different alleles. d. plants and animals can both reproduce sexually.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Ihave made a synthetic cell by placing a solution that is 10% sodium chloride inside a semipermeable membrane through which water can pass but not sodium chloride. if i place this cell into a solution that is 20% sodium chloride what will happen to the size of the cell? will it increase, decrease, or stay the same in size?