![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:30, Tnaaasty5901
Pls quickly! which of the following is true about the behavior of an organism? a. the behavior of an organism is influenced by both its heredity and it’s environment. b. the behavior of an organism is influenced only by the treats it inherits from its parents. c. the behavior of an organism is influenced only by the environment in which it lives in. d. the behavior of an organism is not influenced by either it’s heredity or its environment.
Answers: 2
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, shady1095
Antoine manages a number of apartment buildings that use natural gas for heating, cooking, and laundry. the scatter plot shows the correlation between the outside air temperature and antoine's natural gas bill. which type of correlation does the plot illustrate?
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Organisms closely related have less DNA in common?...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 24.01.2020 20:31
![Konu](/tpl/images/cats/istoriya.png)
History, 24.01.2020 20:31
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/istoriya.png)