Biology, 19.05.2020 23:46, czp

Which two classes make up the majority of crustaceans?

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 12:30, naomi20044

Which statement accurately describes the rock layers? layer 8 is older than layer 1. layer 3 is younger than layer 6. layer 4 and layer 10 are the same relative age. layer 2 and layer 9 are the same relative age.

Answers: 1

continue

Biology, 21.06.2019 22:00, corrineikerd

Protein synthesis actually begins in the nucleus when transcribes a single gene on the dna molecule is copied. the process of copying this gene is called this copy is known as and contains the protein building instructions. this copy is sent out into the cytoplasm to the part of the cell known as the the of the ribosome will join together to form a functional ribosome when they attach to the mrna. as the mrna moves through the ribosome, the message is read by transfer rna brings the correct back to the ribosome. the amino acids are placed in the correct order and are hitched together by

Answers: 3

continue

Biology, 22.06.2019 07:00, okaiikk

According to the cell theory, which describes cells? a. all organisms are composed of multiple cells. b. all cells have the same structure and function. c. cells are found in everything on earth. d. living organisms are not created spontaneously

Answers: 2

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?