About 70% of Americans perceive a bitter taste from the chemical phenylthiocarbamide (PTC). The ability to taste this chemical results from a dominant allele (T) and not being able to taste PTC is the result of having two recessive alleles (t). Albinism is also a single locus trait with normal pigment being dominant (A) and the lack of pigment being recessive (a). A normally pigmented woman who cannot taste PTC has a father who is an albino taster. She marries a homozygous, normally pigmented man who is a taster but who has a mother that does not taste PTC. What are the genotypes of the possible children (choose all that apply)? 1. What percentage of the children will be albinos? 2. What percentage of the children will be non-tasters of PTC?

The table shows dates and appearance of index fossils. which rock layers can be dated most precisely? a) a layer containing both a fossil 4 and a fossil 3 b) a layer containing both a fossil 2 and a fossil 3 c) a layer containing both a fossil 1 and a fossil 4 d) a layer containing both a fossil 1 and a fossil 2

Which of the following forest management practices is best for reestablishing areas of forest?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?