Most compounds that contain carbon can be placed in which chemical group?
acids
organic<...
Biology, 05.05.2020 02:25, adanaguirre17
Most compounds that contain carbon can be placed in which chemical group?
acids
organic
element
nonmetals
first to answer gets brainliest
Answers: 2
Biology, 22.06.2019 02:00, Aysha1311
Many farmers prefer cattle without horns because it is safer for their herds. the allele for no horns (n) is dominant to the allele for the presence of horns (n). a farmer mates a male with horns to a heterozygous female without horns. what is the chance that the offspring will have horns?
Answers: 1
Biology, 22.06.2019 07:30, TheaMusic524
Directions: read the descriptions of the four islands presented in the lesson. 1. list two new traits that each new species of rat might demonstrate as it adapts to the conditions on each island. 2. introduce one of the four new rat species to another island and describe one challenge it would encounter and one success as it adapts to its new environment.
Answers: 2
Biology, 22.06.2019 09:30, preservations
Phosgene is a chemical agent that is formed by decomposition of chlorinated hydrocarbon solvents by ultraviolet radiation. a. false b. true
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 03.02.2021 04:50
Mathematics, 03.02.2021 04:50
Mathematics, 03.02.2021 04:50
Mathematics, 03.02.2021 04:50