Biology, 05.05.2020 06:33, momo842

The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.

AUUUAACUGUUCUGUCUAGAG

1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 02:50, sonyfan

The response is the basis for vaccination. primary secondary tertiary none of the above

Answers: 2

continue

Biology, 22.06.2019 03:50, Jeyson5852

How are gross production and net production different? a. net production is always greater than gross production. b. net production is always less than gross production. only animals have net production. d. only plants have net production. select the best answer from the choices provided

Answers: 1

continue

Biology, 22.06.2019 07:00, fitzsimmonssheovgrbh

Common symptoms of an iron-defiency anemia include muscle weakness shortness of breath and lightheadedness why does iron deficiency causes these symptoms

Answers: 2

continue

Biology, 22.06.2019 14:00, loudermilkb117

Are gametes exactly the same? explain why or why not?

Answers: 1

continue

Do you know the correct answer?

The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is...