The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.
AUUUAACUGUUCUGUCUAGAG
1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answers: 2
Other questions on the subject: Biology
Biology, 21.06.2019 22:00, ellemarshall13
In this case, the statement that people who exercise for an hour may have lower cholesterol levels is .
Answers: 1
Biology, 22.06.2019 07:00, Damagingawsomeness2
Why does miranda have that particular vision of dr hildesheim answer?
Answers: 3
Do you know the correct answer?
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is...
Questions in other subjects:
Mathematics, 06.11.2020 23:40
Biology, 06.11.2020 23:40
Mathematics, 06.11.2020 23:40
History, 06.11.2020 23:40
Mathematics, 06.11.2020 23:40
Mathematics, 06.11.2020 23:40
