Stars go through stages in their life cycle beginning in a nebula. Our Sun is currently described as which of the following?
Group of answer choices
A )A small white dwarf
B) A main sequence yellow star
C) A red supergiant
D) A blue giant

Which sentence best describes the relationship between chlorophyll and the chloroplast? a.) chlorophyll is a chemical found in a chloroplast. b.) chloroplast is a chemical found in a chlorophyll. c.) both chlorophyll and chloroplasts are found in animals. d.) both chlorophyll and chloroplasts make carbon dioxide.

Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?