House finches were found only in western North America until 1939, when a few individuals were released in New York City. These individuals established a breeding population and gradually expanded their range. The western population also expanded its range somewhat eastward, and the two populations have recently come in contact. If the two forms were unable to interbreed when their expanding ranges met, it would be an example of .
A) prezygotic isolation
B) reinforcement
C) allopatric speciation
D) sympatric speciation

What is the ecological role of food chains and food webs

Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?