Biology, 26.04.2020 08:15, pleasehelpme666

Which molecule could he make that consists of long chains of red and black colored balls

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 15:30, synite

Order the steps of protein synthesis. amino acids are lined up in a sequence. rna is modified into mrna. dna is transcribed. a ribosome binds to mrna. chemical bonds are formed and a protein is produced.

Answers: 3

continue

Biology, 22.06.2019 04:30, Nicoleebel2984

Anurse is in the dining room and overhears a new nurse tell a client with body dysmorphic disorder that she's much too thin and must eat more before she can go home. the client bursts into tears and runs out of the dining room. what is the best way for the nurse to address this situation?

Answers: 1

continue

Biology, 22.06.2019 08:00, lmorace

Aparent with freckles is crossed with a parent without freckles. the punnett square shows the possible genotypes and phenotypes of the offspring. which statement accurately describes the probability of phenotypes? a. the offspring are more likely to have freckles. b. the offspring are more likely to have no freckles. c. the likelihood of the offspring having freckles and not having freckles is the same. d. the likelihood of the offspring having freckles and not having freckles cannot be determined.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Do you know the correct answer?

Which molecule could he make that consists of long chains of red and black colored balls...