1. Why do forests not occur in the deserts?
2. Name two biomes that would have the great...
![Biology](/tpl/images/cats/biologiya.png)
Biology, 25.04.2020 23:36, kstyleszdance
1. Why do forests not occur in the deserts?
2. Name two biomes that would have the greatest variety of plants and animals AND why would that happen?
3.How does the shape of a pine tree as well as the shape of the needle leaves adapt to the snowy winters of the taiga?
4. Which leaf can absorb more sunlight, a pine needle or a maple leaf? WHY?
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:20, rosie20052019
What makes a dominant allele different from a recessive allele
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, michellemonroe012305
How energy flows through each level in this energy pyramid. is all the matter and energy from one level transferred to the next level?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:30, pacoburden02
Explain the process that creates the heat of the sun?
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 09.09.2021 21:10
![Konu](/tpl/images/cats/biologiya.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 09.09.2021 21:10
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 09.09.2021 21:10
![Konu](/tpl/images/cats/mkx.png)
Arts, 09.09.2021 21:10
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/himiya.png)
Chemistry, 09.09.2021 21:10
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 09.09.2021 21:10