Which of the following are members of the kingdom Archaebacteria?
a. methanogens c. eukaryotes...
![Biology](/tpl/images/cats/biologiya.png)
![answer](/tpl/images/cats/otvet.png)
Answers: 2
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30, noahslambeenie359
If assuming tasting ptc as a simple gene trait, what other genotype would you select to put in this missing genotype box that could result in this phenotype
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 17:00, gibbss80stu
What is one affect on the australian environment due to the introduction of non-native european rabbits
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 00:30, rebecabosca
What are the base pairing rules? how does this allow for dna replication
Answers: 1
Do you know the correct answer?
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/informatica.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 17.04.2021 17:50
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 17.04.2021 17:50
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 17.04.2021 17:50