Biology
Biology, 22.04.2020 00:11, shay8850

During the process of succession,
OA.
producers typically enter a developing ecosystem before consumers.
OB. only consumers can enter a developing ecosystem.
Oc. only producers can enter a developing ecosystem.
OD. consumers typically enter a developing ecosystem before producers.

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 14:00, leahumelinda
She planned to observe the flowers for the next five days for an hour at the same time each afternoon. then she wou the data in a multiple line graph to compare the number of bees that visited each flower. which statement best descr data in this investigation?
Answers: 3
image
Biology, 21.06.2019 19:30, jonmorton159
Which of the following statements is true? 1. the mantle of the earth is made of solid nickel and iron. 2. the crust of the earth is made of solid nickel and iron. 3. the inner core is made of solid nickel and iron.
Answers: 1
image
Biology, 22.06.2019 04:20, davidoj13
Do you think the gene eef1 alpha1 supports cell theory? explain your response.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
During the process of succession,
OA.
producers typically enter a developing ecosystem b...

Questions in other subjects:

Konu
Mathematics, 02.10.2021 22:20
Konu
Mathematics, 02.10.2021 22:20