17
Which statement is true? *
(5 Points)
Humans need Carbon Dioxide in order to li...
17
Which statement is true? *
(5 Points)
Humans need Carbon Dioxide in order to live.
The circulatory system along with the respiratory system helps get oxygen to every muscle in the body.
Body temperature is controlled by the temperature outside
Red blood cells help heal wounds.
Answers: 1
Biology, 22.06.2019 10:40, ari313
Which of the following factors would not contribute to allopatric speciation? a) a population becomes geographically isolated from the parent population. b) the separated population is small, and genetic drift occurs. c) the isolated population is exposed to different selection pressures than the ancestral population. d) different mutations begin to distinguish the gene pools of the separated populations. e) gene flow between the two populations is extensive.
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:20, ericsmith19
Anybody know this. a haplontic cycle animal initially reproduces by: mitosis binary fission isogamous fertilization meiosis
Answers: 2
Biology, 22.06.2019 19:10, isabellawest2
which is an effect of short-term environmental changes? a) adaptation b) speciation c) extinction d) death (5 points)
Answers: 1
Mathematics, 06.07.2019 11:10
Physics, 06.07.2019 11:10
Mathematics, 06.07.2019 11:10
Mathematics, 06.07.2019 11:10
Mathematics, 06.07.2019 11:10
Mathematics, 06.07.2019 11:10
Mathematics, 06.07.2019 11:10
Mathematics, 06.07.2019 11:10
Geography, 06.07.2019 11:10